Uncategorized

October 11, 2021

book reivew 0

3 pages book reivew about : Homage to Catalonia and this is the link of the book.   https://books.google.com/books?id=UXy3vDumNxwC&printsec=frontcover&dq=homage+to+catalonia+lionel+trilling&hl=en&sa=X&ei=6sI_VYa-EM21yATP6oDgCg&ved=0CCwQ6wEwAQ#v=onepage&q&f=false   Do you need a similar assignment […]
October 11, 2021

research two 2 different countries and discuss differences labor unions comparison united st

Research two (2) different countries and discuss the differences in labor unions in comparison to the United States. Then, provide the most recent labor relation issue(s) […]
October 11, 2021

DNA

I. A double strand of DNA contains the following sequence. 5’ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3’3’ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5’a. Write the 6 reading frames and group nucleotides in codons, i.e. […]
October 11, 2021

2. In corn, green leaf is dominant (L) and albino leaf is recessive (l). Cross 2 heterozygous corn plants. What would be the genotypic ratio of the first generation offspring? Legend: Parents: Punnett Square: Answers:

2.  In corn, green leaf is dominant (L) and albino leaf is recessive (l).  Cross 2 heterozygous corn plants.  What would be the genotypic ratio of […]
Prev page
12345678910111213141516171819202122232425262728293031323334353637383940414243444546474849505152535455565758596061626364656667686970717273747576777879808182838485868788899091929394959697989910010110210310410510610710810911011111211311411511611711811912012112212312412512612712812913013113213313413513613713813914014114214314414514614714814915015115215315415515615715815916016116216316416516616716816917017117217317417517617717817918018118218318418518618718818919019119219319419519619719819920020120220320420520620720820921021121221321421521621721821922022122222322422522622722822923023123223323423523623723823924024124224324424524624724824925025125225325425525625725825926026126226326426526626726826927027127227327427527627727827928028128228328428528628728828929029129229329429529629729829930030130230330430530630730830931031131231331431531631731831932032132232332432532632732832933033133233333433533633733833934034134234334434534634734834935035135235335435535635735835936036136236336436536636736836937037137237337437537637737837938038138238338438538638738838939039139239339439539639739839940040140240340440540640740840941041141241341441541641741841942042142242342442542642742842943043143243343443543643743843944044144244344444544644744844945045145245345445545645745845946046146246346446546646746846947047147247347447547647747847948048148248348448548648748848949049149249349449549649749849950050150250350450550650750850951051151251351451551651751851952052152252352452552652752852953053153253353453553653753853954054154254354454554654754854955055155255355455555655755855956056156256356456556656756856957057157257357457557657757857958058158258358458558658758858959059159259359459559659759859960060160260360460560660760860961061161261361461561661761861962062162262362462562662762862963063163263363463563663763863964064164264364464564664764864965065165265365465565665765865966066166266366466566666766866967067167267367467567667767867968068168268368468568668768868969069169269369469569669769869970070170270370470570670770870971071171271371471571671771871972072172272372472572672772872973073173273373473573673773873974074174274374474574674774874975075175275375475575675775875976076176276376476576676776876977077177277377477577677777877978078178278378478578678778878979079179279379479579679779879980080180280380480580680780880981081181281381481581681781881982082182282382482582682782882983083183283383483583683783883984084184284384484584684784884985085185285385485585685785885986086186286386486586686786886987087187287387487587687787887988088188288388488588688788888989089189289389489589689789889990090190290390490590690790890991091191291391491591691791891992092192292392492592692792892993093193293393493593693793893994094194294394494594694794894995095195295395495595695795895996096196296396496596696796896997097197297397497597697797897998098198298398498598698798898999099199299399499599699799899910001001100210031004100510061007100810091010101110121013101410151016101710181019102010211022102310241025102610271028102910301031103210331034103510361037103810391040104110421043104410451046104710481049105010511052105310541055105610571058105910601061106210631064106510661067106810691070107110721073107410751076107710781079108010811082108310841085108610871088108910901091109210931094109510961097109810991100110111021103110411051106110711081109111011111112111311141115111611171118111911201121112211231124112511261127112811291130113111321133113411351136113711381139114011411142114311441145114611471148114911501151115211531154115511561157115811591160116111621163116411651166116711681169117011711172117311741175117611771178117911801181118211831184118511861187118811891190119111921193119411951196119711981199120012011202120312041205120612071208120912101211121212131214121512161217121812191220122112221223122412251226122712281229123012311232123312341235123612371238123912401241124212431244124512461247124812491250125112521253125412551256125712581259126012611262126312641265126612671268126912701271127212731274127512761277127812791280128112821283128412851286128712881289129012911292129312941295129612971298129913001301130213031304130513061307130813091310131113121313131413151316131713181319132013211322132313241325132613271328132913301331133213331334133513361337133813391340134113421343134413451346134713481349135013511352135313541355135613571358135913601361136213631364136513661367136813691370137113721373137413751376137713781379138013811382138313841385138613871388138913901391139213931394139513961397139813991400140114021403140414051406140714081409141014111412141314141415141614171418141914201421142214231424142514261427142814291430143114321433143414351436143714381439144014411442144314441445144614471448144914501451145214531454145514561457145814591460146114621463146414651466146714681469147014711472147314741475147614771478147914801481148214831484148514861487148814891490149114921493149414951496149714981499150015011502150315041505150615071508150915101511151215131514151515161517151815191520152115221523152415251526152715281529153015311532153315341535153615371538153915401541154215431544154515461547154815491550155115521553155415551556155715581559156015611562156315641565156615671568156915701571157215731574157515761577157815791580158115821583158415851586158715881589159015911592159315941595159615971598159916001601160216031604160516061607160816091610161116121613161416151616161716181619162016211622162316241625162616271628162916301631163216331634163516361637163816391640164116421643164416451646164716481649165016511652165316541655165616571658165916601661166216631664166516661667166816691670167116721673167416751676167716781679168016811682168316841685168616871688168916901691169216931694169516961697169816991700170117021703170417051706170717081709171017111712171317141715171617171718171917201721172217231724172517261727172817291730173117321733173417351736173717381739174017411742174317441745174617471748174917501751175217531754175517561757175817591760176117621763176417651766176717681769177017711772177317741775177617771778177917801781178217831784178517861787178817891790179117921793179417951796179717981799180018011802180318041805180618071808180918101811181218131814181518161817181818191820182118221823182418251826182718281829183018311832183318341835183618371838183918401841184218431844184518461847184818491850185118521853185418551856185718581859186018611862186318641865186618671868186918701871187218731874187518761877187818791880188118821883188418851886188718881889189018911892189318941895189618971898189919001901190219031904190519061907190819091910191119121913191419151916191719181919192019211922192319241925192619271928192919301931193219331934193519361937193819391940194119421943194419451946194719481949195019511952195319541955195619571958195919601961196219631964196519661967196819691970197119721973197419751976197719781979198019811982198319841985198619871988198919901991199219931994199519961997199819992000200120022003200420052006200720082009201020112012201320142015201620172018201920202021202220232024202520262027202820292030203120322033203420352036203720382039204020412042204320442045204620472048204920502051205220532054205520562057205820592060206120622063206420652066206720682069207020712072207320742075207620772078207920802081208220832084208520862087208820892090209120922093209420952096209720982099210021012102210321042105210621072108210921102111211221132114211521162117211821192120212121222123212421252126212721282129213021312132213321342135213621372138213921402141214221432144214521462147214821492150215121522153215421552156215721582159216021612162216321642165216621672168216921702171217221732174217521762177217821792180218121822183218421852186218721882189219021912192219321942195219621972198219922002201220222032204220522062207220822092210221122122213221422152216221722182219222022212222222322242225222622272228222922302231223222332234223522362237223822392240224122422243224422452246224722482249225022512252225322542255225622572258225922602261226222632264226522662267226822692270227122722273227422752276227722782279228022812282228322842285228622872288228922902291229222932294229522962297229822992300230123022303230423052306230723082309231023112312231323142315231623172318231923202321232223232324232523262327232823292330233123322333233423352336233723382339234023412342234323442345234623472348234923502351235223532354235523562357235823592360236123622363236423652366236723682369237023712372237323742375237623772378237923802381238223832384238523862387238823892390239123922393239423952396239723982399240024012402240324042405240624072408240924102411241224132414241524162417241824192420242124222423242424252426242724282429243024312432243324342435243624372438243924402441244224432444244524462447244824492450245124522453245424552456245724582459246024612462246324642465246624672468246924702471247224732474247524762477247824792480248124822483248424852486248724882489249024912492249324942495249624972498249925002501250225032504250525062507250825092510251125122513251425152516251725182519252025212522252325242525252625272528252925302531253225332534253525362537253825392540254125422543254425452546254725482549255025512552255325542555255625572558255925602561256225632564256525662567256825692570257125722573257425752576257725782579258025812582258325842585258625872588258925902591259225932594259525962597259825992600260126022603260426052606260726082609261026112612261326142615261626172618261926202621262226232624262526262627262826292630263126322633263426352636263726382639264026412642264326442645264626472648264926502651265226532654265526562657265826592660266126622663266426652666266726682669267026712672267326742675267626772678267926802681268226832684268526862687268826892690269126922693269426952696269726982699270027012702270327042705270627072708270927102711271227132714271527162717271827192720272127222723272427252726272727282729273027312732273327342735273627372738273927402741274227432744274527462747274827492750275127522753275427552756275727582759276027612762276327642765276627672768276927702771277227732774277527762777277827792780278127822783278427852786278727882789279027912792279327942795279627972798279928002801280228032804280528062807280828092810281128122813281428152816281728182819282028212822282328242825282628272828282928302831283228332834283528362837283828392840284128422843284428452846284728482849285028512852285328542855285628572858285928602861286228632864286528662867286828692870287128722873287428752876287728782879288028812882288328842885288628872888288928902891289228932894289528962897289828992900290129022903290429052906290729082909291029112912291329142915291629172918291929202921292229232924292529262927292829292930293129322933293429352936293729382939294029412942294329442945294629472948294929502951295229532954295529562957295829592960296129622963296429652966296729682969297029712972297329742975297629772978297929802981298229832984298529862987298829892990299129922993299429952996299729982999300030013002300330043005300630073008300930103011301230133014301530163017301830193020302130223023302430253026302730283029303030313032303330343035303630373038303930403041304230433044304530463047304830493050305130523053305430553056305730583059306030613062306330643065306630673068306930703071307230733074307530763077307830793080308130823083308430853086308730883089309030913092309330943095309630973098309931003101310231033104310531063107310831093110311131123113311431153116311731183119312031213122312331243125312631273128312931303131313231333134313531363137313831393140314131423143314431453146314731483149315031513152315331543155315631573158315931603161316231633164316531663167316831693170317131723173317431753176317731783179318031813182318331843185318631873188318931903191319231933194319531963197319831993200320132023203320432053206320732083209321032113212321332143215321632173218321932203221322232233224322532263227322832293230323132323233323432353236323732383239324032413242324332443245324632473248324932503251325232533254325532563257325832593260326132623263326432653266326732683269327032713272327332743275327632773278327932803281328232833284328532863287328832893290329132923293329432953296329732983299330033013302330333043305330633073308330933103311331233133314331533163317331833193320332133223323332433253326332733283329333033313332333333343335333633373338333933403341334233433344334533463347334833493350335133523353335433553356335733583359336033613362336333643365336633673368336933703371337233733374337533763377337833793380338133823383338433853386338733883389339033913392339333943395339633973398339934003401340234033404340534063407340834093410341134123413341434153416341734183419342034213422342334243425342634273428342934303431343234333434343534363437343834393440344134423443344434453446344734483449345034513452345334543455345634573458345934603461346234633464346534663467346834693470347134723473347434753476347734783479348034813482348334843485348634873488348934903491349234933494349534963497349834993500350135023503350435053506350735083509351035113512351335143515351635173518351935203521352235233524352535263527352835293530353135323533353435353536353735383539354035413542354335443545354635473548354935503551355235533554355535563557355835593560356135623563356435653566356735683569357035713572357335743575357635773578357935803581358235833584358535863587358835893590359135923593359435953596359735983599360036013602360336043605360636073608360936103611361236133614361536163617361836193620362136223623362436253626362736283629363036313632363336343635363636373638363936403641364236433644364536463647364836493650365136523653365436553656365736583659366036613662366336643665366636673668366936703671367236733674367536763677367836793680368136823683368436853686368736883689369036913692369336943695369636973698369937003701370237033704370537063707370837093710371137123713371437153716371737183719372037213722372337243725372637273728372937303731373237333734373537363737373837393740374137423743374437453746374737483749375037513752375337543755375637573758375937603761376237633764376537663767376837693770377137723773377437753776377737783779378037813782378337843785378637873788378937903791379237933794379537963797379837993800380138023803380438053806380738083809381038113812381338143815381638173818381938203821382238233824382538263827382838293830383138323833383438353836383738383839384038413842384338443845384638473848384938503851385238533854385538563857385838593860386138623863386438653866386738683869387038713872387338743875387638773878387938803881388238833884388538863887388838893890389138923893389438953896389738983899390039013902390339043905390639073908390939103911391239133914391539163917391839193920392139223923392439253926392739283929393039313932393339343935393639373938393939403941394239433944394539463947394839493950395139523953395439553956395739583959396039613962396339643965396639673968396939703971397239733974397539763977397839793980398139823983398439853986398739883989399039913992399339943995399639973998399940004001400240034004400540064007400840094010401140124013401440154016401740184019402040214022402340244025402640274028402940304031403240334034403540364037403840394040404140424043404440454046404740484049405040514052405340544055405640574058405940604061406240634064406540664067406840694070407140724073407440754076407740784079408040814082408340844085408640874088408940904091409240934094409540964097409840994100410141024103410441054106410741084109411041114112411341144115411641174118411941204121412241234124412541264127412841294130413141324133413441354136413741384139414041414142414341444145414641474148414941504151415241534154415541564157415841594160416141624163416441654166416741684169417041714172417341744175417641774178417941804181418241834184418541864187418841894190419141924193419441954196419741984199420042014202420342044205420642074208420942104211421242134214421542164217421842194220422142224223422442254226422742284229423042314232423342344235423642374238423942404241424242434244424542464247424842494250425142524253425442554256425742584259426042614262426342644265426642674268426942704271427242734274427542764277427842794280428142824283428442854286428742884289429042914292429342944295429642974298429943004301430243034304430543064307430843094310431143124313431443154316431743184319432043214322432343244325432643274328432943304331433243334334433543364337433843394340434143424343434443454346434743484349435043514352435343544355435643574358435943604361436243634364436543664367436843694370437143724373437443754376437743784379438043814382438343844385438643874388438943904391439243934394439543964397439843994400440144024403440444054406440744084409441044114412441344144415441644174418441944204421442244234424442544264427442844294430443144324433443444354436443744384439444044414442444344444445444644474448444944504451445244534454445544564457445844594460446144624463446444654466446744684469447044714472447344744475447644774478447944804481448244834484448544864487448844894490449144924493449444954496449744984499450045014502450345044505450645074508450945104511451245134514451545164517451845194520452145224523452445254526452745284529453045314532453345344535453645374538453945404541454245434544454545464547454845494550455145524553455445554556455745584559456045614562456345644565456645674568456945704571457245734574457545764577457845794580458145824583458445854586458745884589459045914592459345944595459645974598459946004601460246034604460546064607460846094610461146124613461446154616461746184619462046214622462346244625462646274628462946304631463246334634463546364637463846394640464146424643464446454646464746484649465046514652465346544655465646574658465946604661466246634664466546664667466846694670467146724673467446754676467746784679468046814682468346844685468646874688468946904691469246934694469546964697469846994700470147024703470447054706470747084709471047114712471347144715471647174718471947204721472247234724472547264727472847294730473147324733473447354736473747384739474047414742474347444745474647474748474947504751475247534754475547564757475847594760476147624763476447654766476747684769477047714772477347744775477647774778477947804781478247834784478547864787478847894790479147924793479447954796479747984799480048014802480348044805480648074808480948104811481248134814481548164817481848194820482148224823482448254826482748284829483048314832483348344835483648374838483948404841484248434844484548464847484848494850485148524853485448554856485748584859486048614862486348644865486648674868486948704871487248734874487548764877487848794880488148824883488448854886488748884889489048914892489348944895489648974898489949004901490249034904490549064907490849094910491149124913491449154916491749184919492049214922492349244925492649274928492949304931493249334934493549364937493849394940494149424943494449454946494749484949495049514952495349544955495649574958495949604961496249634964496549664967496849694970497149724973497449754976497749784979498049814982498349844985498649874988498949904991499249934994499549964997499849995000500150025003500450055006500750085009501050115012501350145015501650175018501950205021502250235024502550265027502850295030503150325033503450355036503750385039504050415042504350445045504650475048504950505051505250535054505550565057505850595060506150625063506450655066506750685069507050715072507350745075507650775078507950805081508250835084508550865087508850895090509150925093509450955096509750985099510051015102510351045105510651075108510951105111511251135114511551165117511851195120512151225123512451255126512751285129513051315132513351345135513651375138513951405141514251435144514551465147514851495150515151525153515451555156515751585159516051615162516351645165516651675168516951705171517251735174517551765177517851795180518151825183518451855186518751885189519051915192519351945195519651975198519952005201520252035204520552065207520852095210521152125213521452155216521752185219522052215222522352245225522652275228522952305231523252335234523552365237523852395240524152425243524452455246524752485249525052515252525352545255525652575258525952605261526252635264526552665267526852695270527152725273527452755276527752785279528052815282528352845285528652875288528952905291529252935294529552965297529852995300530153025303530453055306530753085309531053115312531353145315531653175318531953205321532253235324532553265327532853295330533153325333533453355336533753385339534053415342534353445345534653475348534953505351535253535354535553565357535853595360536153625363536453655366536753685369537053715372537353745375537653775378537953805381538253835384538553865387538853895390539153925393539453955396539753985399540054015402540354045405540654075408540954105411541254135414541554165417541854195420542154225423542454255426542754285429543054315432543354345435543654375438543954405441544254435444544554465447544854495450545154525453545454555456545754585459546054615462546354645465546654675468546954705471547254735474547554765477547854795480548154825483548454855486548754885489549054915492549354945495549654975498549955005501550255035504550555065507550855095510551155125513551455155516551755185519552055215522552355245525552655275528552955305531553255335534553555365537553855395540554155425543554455455546554755485549555055515552555355545555555655575558555955605561556255635564556555665567556855695570557155725573557455755576557755785579558055815582558355845585558655875588558955905591559255935594559555965597559855995600560156025603560456055606560756085609561056115612561356145615561656175618561956205621562256235624562556265627562856295630563156325633563456355636563756385639564056415642564356445645564656475648564956505651565256535654565556565657565856595660566156625663566456655666566756685669567056715672567356745675567656775678567956805681568256835684568556865687568856895690569156925693569456955696569756985699570057015702570357045705570657075708570957105711571257135714571557165717571857195720572157225723572457255726572757285729573057315732573357345735573657375738573957405741574257435744574557465747574857495750575157525753575457555756575757585759576057615762576357645765576657675768576957705771577257735774577557765777577857795780578157825783578457855786578757885789579057915792579357945795579657975798579958005801580258035804580558065807580858095810581158125813581458155816581758185819582058215822582358245825582658275828582958305831583258335834583558365837583858395840584158425843584458455846584758485849585058515852585358545855585658575858585958605861586258635864586558665867586858695870587158725873587458755876587758785879588058815882588358845885588658875888588958905891589258935894589558965897589858995900590159025903590459055906590759085909591059115912591359145915591659175918591959205921592259235924592559265927592859295930593159325933593459355936593759385939594059415942594359445945594659475948594959505951595259535954595559565957595859595960596159625963596459655966596759685969597059715972597359745975597659775978597959805981598259835984598559865987598859895990599159925993599459955996599759985999600060016002600360046005600660076008600960106011601260136014601560166017601860196020602160226023602460256026602760286029603060316032603360346035603660376038603960406041604260436044604560466047604860496050605160526053605460556056605760586059606060616062606360646065606660676068606960706071607260736074607560766077607860796080608160826083608460856086608760886089609060916092609360946095609660976098609961006101610261036104610561066107610861096110611161126113611461156116611761186119612061216122612361246125612661276128612961306131613261336134613561366137613861396140614161426143614461456146614761486149615061516152615361546155615661576158615961606161616261636164616561666167616861696170617161726173617461756176617761786179618061816182618361846185618661876188618961906191619261936194619561966197619861996200620162026203620462056206620762086209621062116212621362146215621662176218621962206221622262236224622562266227622862296230623162326233623462356236623762386239624062416242624362446245624662476248624962506251625262536254625562566257625862596260626162626263626462656266626762686269627062716272627362746275627662776278627962806281628262836284628562866287628862896290629162926293629462956296629762986299630063016302630363046305630663076308630963106311631263136314631563166317631863196320632163226323632463256326632763286329633063316332633363346335633663376338633963406341634263436344634563466347634863496350635163526353635463556356635763586359636063616362636363646365636663676368636963706371637263736374637563766377637863796380638163826383638463856386638763886389639063916392639363946395639663976398639964006401640264036404640564066407640864096410641164126413641464156416641764186419642064216422642364246425642664276428642964306431643264336434643564366437643864396440644164426443644464456446644764486449645064516452645364546455645664576458645964606461646264636464646564666467646864696470647164726473647464756476647764786479648064816482648364846485648664876488648964906491649264936494649564966497649864996500650165026503650465056506650765086509651065116512651365146515651665176518651965206521652265236524652565266527652865296530653165326533653465356536653765386539654065416542654365446545654665476548654965506551655265536554655565566557655865596560656165626563656465656566656765686569657065716572657365746575657665776578657965806581658265836584658565866587658865896590659165926593659465956596659765986599660066016602660366046605660666076608660966106611661266136614661566166617661866196620662166226623662466256626662766286629663066316632663366346635663666376638663966406641664266436644664566466647664866496650665166526653665466556656665766586659666066616662666366646665666666676668666966706671667266736674667566766677667866796680668166826683668466856686668766886689669066916692669366946695669666976698669967006701670267036704670567066707670867096710671167126713671467156716671767186719672067216722672367246725672667276728672967306731673267336734673567366737673867396740674167426743674467456746674767486749675067516752675367546755675667576758675967606761676267636764676567666767676867696770677167726773677467756776677767786779678067816782678367846785678667876788678967906791679267936794679567966797679867996800680168026803680468056806680768086809681068116812681368146815681668176818681968206821682268236824682568266827682868296830683168326833683468356836683768386839684068416842684368446845684668476848684968506851685268536854685568566857685868596860686168626863686468656866686768686869687068716872687368746875687668776878687968806881688268836884688568866887688868896890689168926893689468956896689768986899690069016902690369046905690669076908690969106911691269136914691569166917691869196920692169226923692469256926692769286929693069316932693369346935693669376938693969406941694269436944694569466947694869496950695169526953695469556956695769586959696069616962696369646965696669676968696969706971697269736974697569766977697869796980698169826983698469856986698769886989699069916992699369946995699669976998699970007001700270037004700570067007700870097010701170127013701470157016701770187019702070217022702370247025702670277028702970307031703270337034703570367037703870397040704170427043704470457046704770487049705070517052705370547055705670577058705970607061706270637064706570667067706870697070707170727073707470757076707770787079708070817082708370847085708670877088708970907091709270937094709570967097709870997100710171027103710471057106710771087109711071117112711371147115711671177118711971207121712271237124712571267127712871297130713171327133713471357136713771387139714071417142714371447145714671477148714971507151715271537154715571567157715871597160716171627163716471657166716771687169717071717172717371747175717671777178717971807181718271837184718571867187718871897190719171927193719471957196719771987199720072017202720372047205720672077208720972107211721272137214721572167217721872197220722172227223722472257226722772287229723072317232723372347235723672377238723972407241724272437244724572467247724872497250725172527253725472557256725772587259726072617262726372647265726672677268726972707271727272737274727572767277727872797280728172827283728472857286728772887289729072917292729372947295729672977298729973007301730273037304730573067307730873097310731173127313731473157316731773187319732073217322732373247325732673277328732973307331733273337334733573367337733873397340734173427343734473457346734773487349735073517352735373547355735673577358735973607361736273637364736573667367736873697370737173727373737473757376737773787379738073817382738373847385738673877388738973907391739273937394739573967397739873997400740174027403740474057406740774087409741074117412741374147415741674177418741974207421742274237424742574267427742874297430743174327433743474357436743774387439744074417442744374447445744674477448744974507451745274537454745574567457745874597460746174627463746474657466746774687469747074717472747374747475747674777478747974807481748274837484748574867487748874897490749174927493749474957496749774987499750075017502750375047505750675077508750975107511751275137514751575167517751875197520752175227523752475257526752775287529753075317532753375347535753675377538753975407541754275437544754575467547754875497550755175527553755475557556755775587559756075617562756375647565756675677568756975707571757275737574757575767577757875797580758175827583758475857586758775887589759075917592759375947595759675977598759976007601760276037604760576067607760876097610761176127613761476157616761776187619762076217622762376247625762676277628762976307631763276337634763576367637763876397640764176427643764476457646764776487649765076517652765376547655765676577658765976607661766276637664766576667667766876697670767176727673767476757676767776787679768076817682768376847685768676877688768976907691769276937694769576967697769876997700770177027703770477057706770777087709771077117712771377147715771677177718771977207721772277237724772577267727772877297730773177327733773477357736773777387739774077417742774377447745774677477748774977507751775277537754775577567757775877597760776177627763776477657766776777687769777077717772777377747775777677777778777977807781778277837784778577867787778877897790779177927793779477957796779777987799780078017802780378047805780678077808780978107811781278137814781578167817781878197820782178227823782478257826782778287829783078317832783378347835783678377838783978407841784278437844784578467847784878497850785178527853785478557856785778587859786078617862786378647865786678677868786978707871787278737874787578767877787878797880788178827883788478857886788778887889789078917892789378947895789678977898789979007901790279037904790579067907790879097910791179127913791479157916791779187919792079217922792379247925792679277928792979307931793279337934793579367937793879397940794179427943794479457946794779487949795079517952795379547955795679577958795979607961796279637964796579667967796879697970797179727973797479757976797779787979798079817982798379847985798679877988798979907991799279937994799579967997799879998000800180028003800480058006800780088009801080118012801380148015801680178018801980208021802280238024802580268027802880298030803180328033803480358036803780388039804080418042804380448045804680478048804980508051805280538054805580568057805880598060806180628063806480658066806780688069807080718072807380748075807680778078807980808081808280838084808580868087808880898090809180928093809480958096809780988099810081018102810381048105810681078108810981108111811281138114811581168117811881198120812181228123812481258126812781288129813081318132813381348135813681378138813981408141814281438144814581468147814881498150815181528153815481558156815781588159816081618162816381648165816681678168816981708171817281738174817581768177817881798180818181828183818481858186818781888189819081918192819381948195819681978198819982008201820282038204820582068207820882098210821182128213821482158216821782188219822082218222822382248225822682278228822982308231823282338234823582368237823882398240824182428243824482458246824782488249825082518252825382548255825682578258825982608261826282638264826582668267826882698270827182728273827482758276827782788279828082818282828382848285828682878288828982908291829282938294829582968297829882998300830183028303830483058306830783088309831083118312831383148315831683178318831983208321832283238324832583268327832883298330833183328333833483358336833783388339834083418342834383448345834683478348834983508351835283538354835583568357835883598360836183628363836483658366836783688369837083718372837383748375837683778378837983808381838283838384838583868387838883898390839183928393839483958396839783988399840084018402840384048405840684078408840984108411841284138414841584168417841884198420842184228423842484258426842784288429843084318432843384348435843684378438843984408441844284438444844584468447844884498450845184528453845484558456845784588459846084618462846384648465846684678468846984708471847284738474847584768477847884798480848184828483848484858486848784888489849084918492849384948495849684978498849985008501850285038504850585068507850885098510851185128513851485158516851785188519852085218522852385248525852685278528852985308531853285338534853585368537853885398540854185428543854485458546854785488549855085518552855385548555855685578558855985608561856285638564856585668567856885698570857185728573857485758576857785788579858085818582858385848585858685878588858985908591859285938594859585968597859885998600860186028603860486058606860786088609861086118612861386148615861686178618861986208621862286238624862586268627862886298630863186328633863486358636863786388639864086418642864386448645864686478648864986508651865286538654865586568657865886598660866186628663866486658666866786688669867086718672867386748675867686778678867986808681868286838684868586868687868886898690869186928693869486958696869786988699870087018702870387048705870687078708870987108711871287138714871587168717871887198720872187228723872487258726872787288729873087318732873387348735873687378738873987408741874287438744874587468747874887498750875187528753875487558756875787588759876087618762876387648765876687678768876987708771877287738774877587768777877887798780878187828783878487858786878787888789879087918792879387948795879687978798879988008801880288038804880588068807880888098810881188128813881488158816881788188819882088218822882388248825882688278828882988308831883288338834883588368837883888398840884188428843884488458846884788488849885088518852885388548855885688578858885988608861886288638864886588668867886888698870887188728873887488758876887788788879888088818882888388848885888688878888888988908891889288938894889588968897889888998900890189028903890489058906890789088909891089118912891389148915891689178918891989208921892289238924892589268927892889298930893189328933893489358936893789388939894089418942894389448945894689478948894989508951895289538954895589568957895889598960896189628963896489658966896789688969897089718972897389748975897689778978897989808981898289838984898589868987898889898990899189928993899489958996899789988999900090019002900390049005900690079008900990109011901290139014901590169017901890199020902190229023902490259026902790289029903090319032903390349035903690379038903990409041904290439044904590469047904890499050905190529053905490559056905790589059906090619062906390649065906690679068906990709071907290739074907590769077907890799080908190829083908490859086908790889089909090919092909390949095909690979098909991009101910291039104910591069107910891099110911191129113911491159116911791189119912091219122912391249125912691279128912991309131913291339134913591369137913891399140914191429143914491459146914791489149915091519152915391549155915691579158915991609161916291639164916591669167916891699170917191729173917491759176917791789179918091819182918391849185918691879188918991909191919291939194919591969197919891999200920192029203920492059206920792089209921092119212921392149215921692179218921992209221922292239224922592269227922892299230923192329233923492359236923792389239924092419242924392449245924692479248924992509251925292539254925592569257925892599260926192629263926492659266926792689269927092719272927392749275927692779278927992809281928292839284928592869287928892899290929192929293929492959296929792989299930093019302930393049305930693079308930993109311931293139314931593169317931893199320932193229323932493259326932793289329933093319332933393349335933693379338933993409341934293439344934593469347934893499350935193529353935493559356935793589359936093619362936393649365936693679368936993709371937293739374937593769377937893799380938193829383938493859386938793889389939093919392939393949395939693979398939994009401940294039404940594069407940894099410941194129413941494159416941794189419942094219422942394249425942694279428942994309431943294339434943594369437943894399440944194429443944494459446944794489449945094519452945394549455945694579458945994609461946294639464946594669467946894699470947194729473947494759476947794789479948094819482948394849485948694879488948994909491949294939494949594969497949894999500950195029503950495059506950795089509951095119512951395149515951695179518951995209521952295239524952595269527952895299530953195329533953495359536953795389539954095419542954395449545954695479548954995509551955295539554955595569557955895599560956195629563956495659566956795689569957095719572957395749575957695779578957995809581958295839584958595869587958895899590959195929593959495959596959795989599960096019602960396049605960696079608960996109611961296139614961596169617961896199620962196229623962496259626962796289629963096319632963396349635963696379638963996409641964296439644964596469647964896499650965196529653965496559656965796589659966096619662966396649665966696679668966996709671967296739674967596769677967896799680968196829683968496859686968796889689969096919692969396949695969696979698969997009701970297039704970597069707970897099710971197129713971497159716971797189719972097219722972397249725972697279728972997309731973297339734973597369737973897399740974197429743974497459746974797489749975097519752975397549755975697579758975997609761976297639764976597669767976897699770977197729773977497759776977797789779978097819782978397849785978697879788978997909791979297939794979597969797979897999800980198029803980498059806980798089809981098119812981398149815981698179818981998209821982298239824982598269827982898299830983198329833983498359836983798389839984098419842984398449845984698479848984998509851985298539854985598569857985898599860986198629863986498659866986798689869987098719872987398749875987698779878987998809881988298839884988598869887988898899890989198929893989498959896989798989899990099019902990399049905990699079908990999109911991299139914991599169917991899199920992199229923992499259926992799289929993099319932993399349935993699379938993999409941994299439944994599469947994899499950995199529953995499559956995799589959996099619962996399649965996699679968996999709971997299739974997599769977997899799980998199829983998499859986998799889989999099919992999399949995999699979998999910000100011000210003100041000510006100071000810009100101001110012100131001410015100161001710018100191002010021100221002310024100251002610027100281002910030100311003210033100341003510036100371003810039100401004110042100431004410045100461004710048100491005010051100521005310054100551005610057100581005910060100611006210063100641006510066100671006810069100701007110072100731007410075100761007710078100791008010081100821008310084100851008610087100881008910090100911009210093100941009510096100971009810099101001010110102101031010410105101061010710108101091011010111101121011310114101151011610117101181011910120101211012210123101241012510126101271012810129101301013110132101331013410135101361013710138101391014010141101421014310144101451014610147101481014910150101511015210153101541015510156101571015810159101601016110162101631016410165101661016710168101691017010171101721017310174101751017610177101781017910180101811018210183101841018510186101871018810189101901019110192101931019410195101961019710198101991020010201102021020310204102051020610207102081020910210102111021210213102141021510216102171021810219102201022110222102231022410225102261022710228102291023010231102321023310234102351023610237102381023910240102411024210243102441024510246102471024810249102501025110252102531025410255102561025710258102591026010261102621026310264102651026610267102681026910270102711027210273102741027510276102771027810279102801028110282102831028410285102861028710288102891029010291102921029310294102951029610297102981029910300103011030210303103041030510306103071030810309103101031110312103131031410315103161031710318103191032010321103221032310324103251032610327103281032910330103311033210333103341033510336103371033810339103401034110342103431034410345103461034710348103491035010351103521035310354103551035610357103581035910360103611036210363103641036510366103671036810369103701037110372103731037410375103761037710378103791038010381103821038310384103851038610387103881038910390103911039210393103941039510396103971039810399104001040110402104031040410405104061040710408104091041010411104121041310414104151041610417104181041910420104211042210423104241042510426104271042810429104301043110432104331043410435104361043710438104391044010441104421044310444104451044610447104481044910450104511045210453104541045510456104571045810459104601046110462104631046410465104661046710468104691047010471104721047310474104751047610477104781047910480104811048210483104841048510486104871048810489104901049110492104931049410495104961049710498104991050010501105021050310504105051050610507105081050910510105111051210513105141051510516105171051810519105201052110522105231052410525105261052710528105291053010531105321053310534105351053610537105381053910540105411054210543105441054510546105471054810549105501055110552105531055410555105561055710558105591056010561105621056310564105651056610567105681056910570105711057210573105741057510576105771057810579105801058110582105831058410585105861058710588105891059010591105921059310594105951059610597105981059910600106011060210603106041060510606106071060810609106101061110612106131061410615106161061710618106191062010621106221062310624106251062610627106281062910630106311063210633106341063510636106371063810639106401064110642106431064410645106461064710648106491065010651106521065310654106551065610657106581065910660106611066210663106641066510666106671066810669106701067110672106731067410675106761067710678106791068010681106821068310684106851068610687106881068910690106911069210693106941069510696106971069810699107001070110702107031070410705107061070710708107091071010711107121071310714107151071610717107181071910720107211072210723107241072510726107271072810729107301073110732107331073410735107361073710738107391074010741107421074310744107451074610747107481074910750107511075210753107541075510756107571075810759107601076110762107631076410765107661076710768107691077010771107721077310774107751077610777107781077910780107811078210783107841078510786107871078810789107901079110792107931079410795107961079710798107991080010801108021080310804108051080610807108081080910810108111081210813108141081510816108171081810819108201082110822108231082410825108261082710828108291083010831108321083310834108351083610837108381083910840108411084210843108441084510846108471084810849108501085110852108531085410855108561085710858108591086010861108621086310864108651086610867108681086910870108711087210873108741087510876108771087810879108801088110882108831088410885108861088710888108891089010891108921089310894108951089610897108981089910900109011090210903109041090510906109071090810909109101091110912109131091410915109161091710918109191092010921109221092310924109251092610927109281092910930109311093210933109341093510936109371093810939109401094110942109431094410945109461094710948109491095010951109521095310954109551095610957109581095910960109611096210963109641096510966109671096810969109701097110972109731097410975109761097710978109791098010981109821098310984109851098610987109881098910990109911099210993109941099510996109971099810999110001100111002110031100411005110061100711008110091101011011110121101311014110151101611017110181101911020110211102211023110241102511026110271102811029110301103111032110331103411035110361103711038110391104011041110421104311044110451104611047110481104911050110511105211053110541105511056110571105811059110601106111062110631106411065110661106711068110691107011071110721107311074110751107611077110781107911080110811108211083110841108511086110871108811089110901109111092110931109411095110961109711098110991110011101111021110311104111051110611107111081110911110111111111211113111141111511116111171111811119111201112111122111231112411125111261112711128111291113011131111321113311134111351113611137111381113911140111411114211143111441114511146111471114811149111501115111152111531115411155111561115711158111591116011161111621116311164111651116611167111681116911170111711117211173111741117511176111771117811179111801118111182111831118411185111861118711188111891119011191111921119311194111951119611197111981119911200112011120211203112041120511206112071120811209112101121111212112131121411215112161121711218112191122011221112221122311224112251122611227112281122911230112311123211233112341123511236112371123811239112401124111242112431124411245112461124711248112491125011251112521125311254112551125611257112581125911260112611126211263112641126511266112671126811269112701127111272112731127411275112761127711278112791128011281112821128311284112851128611287112881128911290112911129211293112941129511296112971129811299113001130111302113031130411305113061130711308113091131011311113121131311314113151131611317113181131911320113211132211323113241132511326113271132811329113301133111332113331133411335113361133711338113391134011341113421134311344113451134611347113481134911350113511135211353113541135511356113571135811359113601136111362113631136411365113661136711368113691137011371113721137311374113751137611377113781137911380113811138211383113841138511386113871138811389113901139111392113931139411395113961139711398113991140011401114021140311404114051140611407114081140911410114111141211413114141141511416114171141811419114201142111422114231142411425114261142711428114291143011431114321143311434114351143611437114381143911440114411144211443114441144511446114471144811449114501145111452114531145411455114561145711458114591146011461114621146311464114651146611467114681146911470114711147211473114741147511476114771147811479114801148111482114831148411485114861148711488114891149011491114921149311494114951149611497114981149911500115011150211503115041150511506115071150811509115101151111512115131151411515115161151711518115191152011521115221152311524115251152611527115281152911530115311153211533115341153511536115371153811539115401154111542115431154411545115461154711548115491155011551115521155311554115551155611557115581155911560115611156211563115641156511566115671156811569115701157111572115731157411575115761157711578115791158011581115821158311584115851158611587115881158911590115911159211593115941159511596115971159811599116001160111602116031160411605116061160711608116091161011611116121161311614116151161611617116181161911620116211162211623116241162511626116271162811629116301163111632116331163411635116361163711638116391164011641116421164311644116451164611647116481164911650116511165211653116541165511656116571165811659116601166111662116631166411665116661166711668116691167011671116721167311674116751167611677116781167911680116811168211683116841168511686116871168811689116901169111692116931169411695116961169711698116991170011701117021170311704117051170611707117081170911710117111171211713117141171511716117171171811719117201172111722117231172411725117261172711728117291173011731117321173311734117351173611737117381173911740117411174211743117441174511746117471174811749117501175111752117531175411755117561175711758117591176011761117621176311764117651176611767117681176911770117711177211773117741177511776117771177811779117801178111782117831178411785117861178711788117891179011791117921179311794117951179611797117981179911800118011180211803118041180511806118071180811809118101181111812118131181411815118161181711818118191182011821118221182311824118251182611827118281182911830118311183211833118341183511836118371183811839118401184111842118431184411845118461184711848118491185011851118521185311854118551185611857118581185911860118611186211863118641186511866118671186811869118701187111872118731187411875118761187711878118791188011881118821188311884118851188611887118881188911890118911189211893118941189511896118971189811899119001190111902119031190411905119061190711908119091191011911119121191311914119151191611917119181191911920119211192211923119241192511926119271192811929119301193111932119331193411935119361193711938119391194011941119421194311944119451194611947119481194911950119511195211953119541195511956119571195811959119601196111962119631196411965119661196711968119691197011971119721197311974119751197611977119781197911980119811198211983119841198511986119871198811989119901199111992119931199411995119961199711998119991200012001120021200312004120051200612007120081200912010120111201212013120141201512016120171201812019120201202112022120231202412025120261202712028120291203012031120321203312034120351203612037120381203912040120411204212043120441204512046120471204812049120501205112052120531205412055120561205712058120591206012061120621206312064120651206612067120681206912070120711207212073120741207512076120771207812079120801208112082120831208412085120861208712088120891209012091120921209312094120951209612097120981209912100121011210212103121041210512106121071210812109121101211112112121131211412115121161211712118121191212012121121221212312124121251212612127121281212912130121311213212133121341213512136121371213812139121401214112142121431214412145121461214712148121491215012151121521215312154121551215612157121581215912160121611216212163121641216512166121671216812169121701217112172121731217412175121761217712178121791218012181121821218312184121851218612187121881218912190121911219212193121941219512196121971219812199122001220112202122031220412205122061220712208122091221012211122121221312214122151221612217122181221912220122211222212223122241222512226122271222812229122301223112232122331223412235122361223712238122391224012241122421224312244122451224612247122481224912250122511225212253122541225512256122571225812259122601226112262122631226412265122661226712268122691227012271122721227312274122751227612277122781227912280122811228212283122841228512286122871228812289122901229112292122931229412295122961229712298122991230012301123021230312304123051230612307123081230912310123111231212313123141231512316123171231812319123201232112322123231232412325123261232712328123291233012331123321233312334123351233612337123381233912340123411234212343123441234512346123471234812349123501235112352123531235412355123561235712358123591236012361123621236312364123651236612367123681236912370123711237212373123741237512376123771237812379123801238112382123831238412385123861238712388123891239012391123921239312394123951239612397123981239912400124011240212403124041240512406124071240812409124101241112412124131241412415124161241712418124191242012421124221242312424124251242612427124281242912430124311243212433124341243512436124371243812439124401244112442124431244412445124461244712448124491245012451124521245312454124551245612457124581245912460124611246212463124641246512466124671246812469124701247112472124731247412475124761247712478124791248012481124821248312484124851248612487124881248912490124911249212493124941249512496124971249812499125001250112502125031250412505125061250712508125091251012511125121251312514125151251612517125181251912520125211252212523125241252512526125271252812529125301253112532125331253412535125361253712538125391254012541125421254312544125451254612547125481254912550125511255212553125541255512556125571255812559125601256112562125631256412565125661256712568125691257012571125721257312574125751257612577125781257912580125811258212583125841258512586125871258812589125901259112592125931259412595125961259712598125991260012601126021260312604126051260612607126081260912610126111261212613126141261512616126171261812619126201262112622126231262412625126261262712628126291263012631126321263312634126351263612637126381263912640126411264212643126441264512646126471264812649126501265112652126531265412655126561265712658126591266012661126621266312664126651266612667126681266912670126711267212673126741267512676126771267812679126801268112682126831268412685126861268712688126891269012691126921269312694126951269612697126981269912700127011270212703127041270512706127071270812709127101271112712127131271412715127161271712718127191272012721127221272312724127251272612727127281272912730127311273212733127341273512736127371273812739127401274112742127431274412745127461274712748127491275012751127521275312754127551275612757127581275912760127611276212763127641276512766127671276812769127701277112772127731277412775127761277712778127791278012781127821278312784127851278612787127881278912790127911279212793127941279512796127971279812799128001280112802128031280412805128061280712808128091281012811128121281312814128151281612817128181281912820128211282212823128241282512826128271282812829128301283112832128331283412835128361283712838128391284012841128421284312844128451284612847128481284912850128511285212853128541285512856128571285812859128601286112862128631286412865128661286712868128691287012871128721287312874128751287612877128781287912880128811288212883128841288512886128871288812889128901289112892128931289412895128961289712898128991290012901129021290312904129051290612907129081290912910129111291212913129141291512916129171291812919129201292112922129231292412925129261292712928129291293012931129321293312934129351293612937129381293912940129411294212943129441294512946129471294812949129501295112952129531295412955129561295712958129591296012961129621296312964129651296612967129681296912970129711297212973129741297512976129771297812979129801298112982129831298412985129861298712988129891299012991129921299312994129951299612997129981299913000130011300213003130041300513006130071300813009130101301113012130131301413015130161301713018130191302013021130221302313024130251302613027130281302913030130311303213033130341303513036130371303813039130401304113042130431304413045130461304713048130491305013051130521305313054130551305613057130581305913060130611306213063130641306513066130671306813069130701307113072130731307413075130761307713078130791308013081130821308313084130851308613087130881308913090130911309213093130941309513096130971309813099131001310113102131031310413105131061310713108131091311013111131121311313114131151311613117131181311913120131211312213123131241312513126131271312813129131301313113132131331313413135131361313713138131391314013141131421314313144131451314613147131481314913150131511315213153131541315513156131571315813159131601316113162131631316413165131661316713168131691317013171131721317313174131751317613177131781317913180131811318213183131841318513186131871318813189131901319113192131931319413195131961319713198131991320013201132021320313204132051320613207132081320913210132111321213213132141321513216132171321813219132201322113222132231322413225132261322713228132291323013231132321323313234132351323613237132381323913240132411324213243132441324513246132471324813249132501325113252132531325413255132561325713258132591326013261132621326313264132651326613267132681326913270132711327213273132741327513276132771327813279132801328113282132831328413285132861328713288132891329013291132921329313294132951329613297132981329913300133011330213303133041330513306133071330813309133101331113312133131331413315133161331713318133191332013321133221332313324133251332613327133281332913330133311333213333133341333513336133371333813339133401334113342133431334413345133461334713348133491335013351133521335313354133551335613357133581335913360133611336213363133641336513366133671336813369133701337113372133731337413375133761337713378133791338013381133821338313384133851338613387133881338913390133911339213393133941339513396133971339813399134001340113402134031340413405134061340713408134091341013411134121341313414134151341613417134181341913420134211342213423134241342513426134271342813429134301343113432134331343413435134361343713438134391344013441134421344313444134451344613447134481344913450134511345213453134541345513456134571345813459134601346113462134631346413465134661346713468134691347013471134721347313474134751347613477134781347913480134811348213483134841348513486134871348813489134901349113492134931349413495134961349713498134991350013501135021350313504135051350613507135081350913510135111351213513135141351513516135171351813519135201352113522135231352413525135261352713528135291353013531135321353313534135351353613537135381353913540135411354213543135441354513546135471354813549135501355113552135531355413555135561355713558135591356013561135621356313564135651356613567135681356913570135711357213573135741357513576135771357813579135801358113582135831358413585135861358713588135891359013591135921359313594135951359613597135981359913600136011360213603136041360513606136071360813609136101361113612136131361413615136161361713618136191362013621136221362313624136251362613627136281362913630136311363213633136341363513636136371363813639136401364113642136431364413645136461364713648136491365013651136521365313654136551365613657136581365913660136611366213663136641366513666136671366813669136701367113672136731367413675136761367713678136791368013681136821368313684136851368613687136881368913690136911369213693136941369513696136971369813699137001370113702137031370413705137061370713708137091371013711137121371313714137151371613717137181371913720137211372213723137241372513726137271372813729137301373113732137331373413735137361373713738137391374013741137421374313744137451374613747137481374913750137511375213753137541375513756137571375813759137601376113762137631376413765137661376713768137691377013771137721377313774137751377613777137781377913780137811378213783137841378513786137871378813789137901379113792137931379413795137961379713798137991380013801138021380313804138051380613807138081380913810138111381213813138141381513816138171381813819138201382113822138231382413825138261382713828138291383013831138321383313834138351383613837138381383913840138411384213843138441384513846138471384813849138501385113852138531385413855138561385713858138591386013861138621386313864138651386613867138681386913870138711387213873138741387513876138771387813879138801388113882138831388413885138861388713888138891389013891138921389313894138951389613897138981389913900139011390213903139041390513906139071390813909139101391113912139131391413915139161391713918139191392013921139221392313924139251392613927139281392913930139311393213933139341393513936139371393813939139401394113942139431394413945139461394713948139491395013951139521395313954139551395613957139581395913960139611396213963139641396513966139671396813969139701397113972139731397413975139761397713978139791398013981139821398313984139851398613987139881398913990139911399213993139941399513996139971399813999140001400114002140031400414005140061400714008140091401014011140121401314014140151401614017140181401914020140211402214023140241402514026140271402814029140301403114032140331403414035140361403714038140391404014041140421404314044140451404614047140481404914050140511405214053140541405514056140571405814059140601406114062140631406414065140661406714068140691407014071140721407314074140751407614077140781407914080140811408214083140841408514086140871408814089140901409114092140931409414095140961409714098140991410014101141021410314104141051410614107141081410914110141111411214113141141411514116141171411814119141201412114122141231412414125141261412714128141291413014131141321413314134141351413614137141381413914140141411414214143141441414514146141471414814149141501415114152141531415414155141561415714158141591416014161141621416314164141651416614167141681416914170141711417214173141741417514176141771417814179141801418114182141831418414185141861418714188141891419014191141921419314194141951419614197141981419914200142011420214203142041420514206142071420814209142101421114212142131421414215142161421714218142191422014221142221422314224142251422614227142281422914230142311423214233142341423514236142371423814239142401424114242142431424414245142461424714248142491425014251142521425314254142551425614257142581425914260142611426214263142641426514266142671426814269142701427114272142731427414275142761427714278142791428014281142821428314284142851428614287142881428914290142911429214293142941429514296142971429814299143001430114302143031430414305143061430714308143091431014311143121431314314143151431614317143181431914320143211432214323143241432514326143271432814329143301433114332143331433414335143361433714338143391434014341143421434314344143451434614347143481434914350143511435214353143541435514356143571435814359143601436114362143631436414365143661436714368143691437014371143721437314374143751437614377143781437914380143811438214383143841438514386143871438814389143901439114392143931439414395143961439714398143991440014401144021440314404144051440614407144081440914410144111441214413144141441514416144171441814419144201442114422144231442414425144261442714428144291443014431144321443314434144351443614437144381443914440144411444214443144441444514446144471444814449144501445114452144531445414455144561445714458144591446014461144621446314464144651446614467144681446914470144711447214473144741447514476144771447814479144801448114482144831448414485144861448714488144891449014491144921449314494144951449614497144981449914500145011450214503145041450514506145071450814509145101451114512145131451414515145161451714518145191452014521145221452314524145251452614527145281452914530145311453214533145341453514536145371453814539145401454114542145431454414545145461454714548145491455014551145521455314554145551455614557145581455914560145611456214563145641456514566145671456814569145701457114572145731457414575145761457714578145791458014581145821458314584145851458614587145881458914590145911459214593145941459514596145971459814599146001460114602146031460414605146061460714608146091461014611146121461314614146151461614617146181461914620146211462214623146241462514626146271462814629146301463114632146331463414635146361463714638146391464014641146421464314644146451464614647146481464914650146511465214653146541465514656146571465814659146601466114662146631466414665146661466714668146691467014671146721467314674146751467614677146781467914680146811468214683146841468514686146871468814689146901469114692146931469414695146961469714698146991470014701147021470314704147051470614707147081470914710147111471214713147141471514716147171471814719147201472114722147231472414725147261472714728147291473014731147321473314734147351473614737147381473914740147411474214743147441474514746147471474814749147501475114752147531475414755147561475714758147591476014761147621476314764147651476614767147681476914770147711477214773147741477514776147771477814779147801478114782147831478414785147861478714788147891479014791147921479314794147951479614797147981479914800148011480214803148041480514806148071480814809148101481114812148131481414815148161481714818148191482014821148221482314824148251482614827148281482914830148311483214833148341483514836148371483814839148401484114842148431484414845148461484714848148491485014851148521485314854148551485614857148581485914860148611486214863148641486514866148671486814869148701487114872148731487414875148761487714878148791488014881148821488314884148851488614887148881488914890148911489214893148941489514896148971489814899149001490114902149031490414905149061490714908149091491014911149121491314914149151491614917149181491914920149211492214923149241492514926149271492814929149301493114932149331493414935149361493714938149391494014941149421494314944149451494614947149481494914950149511495214953149541495514956149571495814959149601496114962149631496414965149661496714968149691497014971149721497314974149751497614977149781497914980149811498214983149841498514986149871498814989149901499114992149931499414995149961499714998149991500015001150021500315004150051500615007150081500915010150111501215013150141501515016150171501815019150201502115022150231502415025150261502715028150291503015031150321503315034150351503615037150381503915040150411504215043150441504515046150471504815049150501505115052150531505415055150561505715058150591506015061150621506315064150651506615067150681506915070150711507215073150741507515076150771507815079150801508115082150831508415085150861508715088150891509015091150921509315094150951509615097150981509915100151011510215103151041510515106151071510815109151101511115112151131511415115151161511715118151191512015121151221512315124151251512615127151281512915130151311513215133151341513515136151371513815139151401514115142151431514415145151461514715148151491515015151151521515315154151551515615157151581515915160151611516215163151641516515166151671516815169151701517115172151731517415175151761517715178151791518015181151821518315184151851518615187151881518915190151911519215193151941519515196151971519815199152001520115202152031520415205152061520715208152091521015211152121521315214152151521615217152181521915220152211522215223152241522515226152271522815229152301523115232152331523415235152361523715238152391524015241152421524315244152451524615247152481524915250152511525215253152541525515256152571525815259152601526115262152631526415265152661526715268152691527015271152721527315274152751527615277152781527915280152811528215283152841528515286152871528815289152901529115292152931529415295152961529715298152991530015301153021530315304153051530615307153081530915310153111531215313153141531515316153171531815319153201532115322153231532415325153261532715328153291533015331153321533315334153351533615337153381533915340153411534215343153441534515346153471534815349153501535115352153531535415355153561535715358153591536015361153621536315364153651536615367153681536915370153711537215373153741537515376153771537815379153801538115382153831538415385153861538715388153891539015391153921539315394153951539615397153981539915400154011540215403154041540515406154071540815409154101541115412154131541415415154161541715418154191542015421154221542315424154251542615427154281542915430154311543215433154341543515436154371543815439154401544115442154431544415445154461544715448154491545015451154521545315454154551545615457154581545915460154611546215463154641546515466154671546815469154701547115472154731547415475154761547715478154791548015481154821548315484154851548615487154881548915490154911549215493154941549515496154971549815499155001550115502155031550415505155061550715508155091551015511155121551315514155151551615517155181551915520155211552215523155241552515526155271552815529155301553115532155331553415535155361553715538155391554015541155421554315544155451554615547155481554915550155511555215553155541555515556155571555815559155601556115562155631556415565155661556715568155691557015571155721557315574155751557615577155781557915580155811558215583155841558515586155871558815589155901559115592155931559415595155961559715598155991560015601156021560315604156051560615607156081560915610156111561215613156141561515616156171561815619156201562115622156231562415625156261562715628156291563015631156321563315634156351563615637156381563915640156411564215643156441564515646156471564815649156501565115652156531565415655156561565715658156591566015661156621566315664156651566615667156681566915670156711567215673156741567515676156771567815679156801568115682156831568415685156861568715688156891569015691156921569315694156951569615697156981569915700157011570215703157041570515706157071570815709157101571115712157131571415715157161571715718157191572015721157221572315724157251572615727157281572915730157311573215733157341573515736157371573815739157401574115742157431574415745157461574715748157491575015751157521575315754157551575615757157581575915760157611576215763157641576515766157671576815769157701577115772157731577415775157761577715778157791578015781157821578315784157851578615787157881578915790157911579215793157941579515796157971579815799158001580115802158031580415805158061580715808158091581015811158121581315814158151581615817158181581915820158211582215823158241582515826158271582815829158301583115832158331583415835158361583715838158391584015841158421584315844158451584615847158481584915850158511585215853158541585515856158571585815859158601586115862158631586415865158661586715868158691587015871158721587315874158751587615877158781587915880158811588215883158841588515886158871588815889158901589115892158931589415895158961589715898158991590015901159021590315904159051590615907159081590915910159111591215913159141591515916159171591815919159201592115922159231592415925159261592715928159291593015931159321593315934159351593615937159381593915940159411594215943159441594515946159471594815949159501595115952159531595415955159561595715958159591596015961159621596315964159651596615967159681596915970159711597215973159741597515976159771597815979159801598115982159831598415985159861598715988159891599015991159921599315994159951599615997159981599916000160011600216003160041600516006160071600816009160101601116012160131601416015160161601716018160191602016021160221602316024160251602616027160281602916030160311603216033160341603516036160371603816039160401604116042160431604416045160461604716048160491605016051160521605316054160551605616057160581605916060160611606216063160641606516066160671606816069160701607116072160731607416075160761607716078160791608016081160821608316084160851608616087160881608916090160911609216093160941609516096160971609816099161001610116102161031610416105161061610716108161091611016111161121611316114161151611616117161181611916120161211612216123161241612516126161271612816129161301613116132161331613416135161361613716138161391614016141161421614316144161451614616147161481614916150161511615216153161541615516156161571615816159161601616116162161631616416165161661616716168161691617016171161721617316174161751617616177161781617916180161811618216183161841618516186161871618816189161901619116192161931619416195161961619716198161991620016201162021620316204162051620616207162081620916210162111621216213162141621516216162171621816219162201622116222162231622416225162261622716228162291623016231162321623316234162351623616237162381623916240162411624216243162441624516246162471624816249162501625116252162531625416255162561625716258162591626016261162621626316264162651626616267162681626916270162711627216273162741627516276162771627816279162801628116282162831628416285162861628716288162891629016291162921629316294162951629616297162981629916300163011630216303163041630516306163071630816309163101631116312163131631416315163161631716318163191632016321163221632316324163251632616327163281632916330163311633216333163341633516336163371633816339163401634116342163431634416345163461634716348163491635016351163521635316354163551635616357163581635916360163611636216363163641636516366163671636816369163701637116372163731637416375163761637716378163791638016381163821638316384163851638616387163881638916390163911639216393163941639516396163971639816399164001640116402164031640416405164061640716408164091641016411164121641316414164151641616417164181641916420164211642216423164241642516426164271642816429164301643116432164331643416435164361643716438164391644016441164421644316444164451644616447164481644916450164511645216453164541645516456164571645816459164601646116462164631646416465164661646716468164691647016471164721647316474164751647616477164781647916480164811648216483164841648516486164871648816489164901649116492164931649416495164961649716498164991650016501165021650316504165051650616507165081650916510165111651216513165141651516516165171651816519165201652116522165231652416525165261652716528165291653016531165321653316534165351653616537165381653916540165411654216543165441654516546165471654816549165501655116552165531655416555165561655716558165591656016561165621656316564165651656616567165681656916570165711657216573165741657516576165771657816579165801658116582165831658416585165861658716588165891659016591165921659316594165951659616597165981659916600166011660216603166041660516606166071660816609166101661116612166131661416615166161661716618166191662016621166221662316624166251662616627166281662916630166311663216633166341663516636166371663816639166401664116642166431664416645166461664716648166491665016651166521665316654166551665616657166581665916660166611666216663166641666516666166671666816669166701667116672166731667416675166761667716678166791668016681166821668316684166851668616687166881668916690166911669216693166941669516696166971669816699167001670116702167031670416705167061670716708167091671016711167121671316714167151671616717167181671916720167211672216723167241672516726167271672816729167301673116732167331673416735167361673716738167391674016741167421674316744167451674616747167481674916750167511675216753167541675516756167571675816759167601676116762167631676416765167661676716768167691677016771167721677316774167751677616777167781677916780167811678216783167841678516786167871678816789167901679116792167931679416795167961679716798167991680016801168021680316804168051680616807168081680916810168111681216813168141681516816168171681816819168201682116822168231682416825168261682716828168291683016831168321683316834168351683616837168381683916840168411684216843168441684516846168471684816849168501685116852168531685416855168561685716858168591686016861168621686316864168651686616867168681686916870168711687216873168741687516876168771687816879168801688116882168831688416885168861688716888168891689016891168921689316894168951689616897168981689916900169011690216903169041690516906169071690816909169101691116912169131691416915169161691716918169191692016921169221692316924169251692616927169281692916930169311693216933169341693516936169371693816939169401694116942169431694416945169461694716948169491695016951169521695316954169551695616957169581695916960169611696216963169641696516966169671696816969169701697116972169731697416975169761697716978169791698016981169821698316984169851698616987169881698916990169911699216993169941699516996169971699816999170001700117002170031700417005170061700717008170091701017011170121701317014170151701617017170181701917020170211702217023170241702517026170271702817029170301703117032170331703417035170361703717038170391704017041170421704317044170451704617047170481704917050170511705217053170541705517056170571705817059170601706117062170631706417065170661706717068170691707017071170721707317074170751707617077170781707917080170811708217083170841708517086170871708817089170901709117092170931709417095170961709717098170991710017101171021710317104171051710617107171081710917110171111711217113171141711517116171171711817119171201712117122171231712417125171261712717128171291713017131171321713317134171351713617137171381713917140171411714217143171441714517146171471714817149171501715117152171531715417155171561715717158171591716017161171621716317164171651716617167171681716917170171711717217173171741717517176171771717817179171801718117182171831718417185171861718717188171891719017191171921719317194171951719617197171981719917200172011720217203172041720517206172071720817209172101721117212172131721417215172161721717218172191722017221172221722317224172251722617227172281722917230172311723217233172341723517236172371723817239172401724117242172431724417245172461724717248172491725017251172521725317254172551725617257172581725917260172611726217263172641726517266172671726817269172701727117272172731727417275172761727717278172791728017281172821728317284172851728617287172881728917290172911729217293172941729517296172971729817299173001730117302173031730417305173061730717308173091731017311173121731317314173151731617317173181731917320173211732217323173241732517326173271732817329173301733117332173331733417335173361733717338173391734017341173421734317344173451734617347173481734917350173511735217353173541735517356173571735817359173601736117362173631736417365173661736717368173691737017371173721737317374173751737617377173781737917380173811738217383173841738517386173871738817389173901739117392173931739417395173961739717398173991740017401174021740317404174051740617407174081740917410174111741217413174141741517416174171741817419174201742117422174231742417425174261742717428174291743017431174321743317434174351743617437174381743917440174411744217443174441744517446174471744817449174501745117452174531745417455174561745717458174591746017461174621746317464174651746617467174681746917470174711747217473174741747517476174771747817479174801748117482174831748417485174861748717488174891749017491174921749317494174951749617497174981749917500175011750217503175041750517506175071750817509175101751117512175131751417515175161751717518175191752017521175221752317524175251752617527175281752917530175311753217533175341753517536175371753817539175401754117542175431754417545175461754717548175491755017551175521755317554175551755617557175581755917560175611756217563175641756517566175671756817569175701757117572175731757417575175761757717578175791758017581175821758317584175851758617587175881758917590175911759217593175941759517596175971759817599176001760117602176031760417605176061760717608176091761017611176121761317614176151761617617176181761917620176211762217623176241762517626176271762817629176301763117632176331763417635176361763717638176391764017641176421764317644176451764617647176481764917650176511765217653176541765517656176571765817659176601766117662176631766417665176661766717668176691767017671176721767317674176751767617677176781767917680176811768217683176841768517686176871768817689176901769117692176931769417695176961769717698176991770017701177021770317704177051770617707177081770917710177111771217713177141771517716177171771817719177201772117722177231772417725177261772717728177291773017731177321773317734177351773617737177381773917740177411774217743177441774517746177471774817749177501775117752177531775417755177561775717758177591776017761177621776317764177651776617767177681776917770177711777217773177741777517776177771777817779177801778117782177831778417785177861778717788177891779017791177921779317794177951779617797177981779917800178011780217803178041780517806178071780817809178101781117812178131781417815178161781717818178191782017821178221782317824178251782617827178281782917830178311783217833178341783517836178371783817839178401784117842178431784417845178461784717848178491785017851178521785317854178551785617857178581785917860178611786217863178641786517866178671786817869178701787117872178731787417875178761787717878178791788017881178821788317884178851788617887178881788917890178911789217893178941789517896178971789817899179001790117902179031790417905179061790717908179091791017911179121791317914179151791617917179181791917920179211792217923179241792517926179271792817929179301793117932179331793417935179361793717938179391794017941179421794317944179451794617947179481794917950179511795217953179541795517956179571795817959179601796117962179631796417965179661796717968179691797017971179721797317974179751797617977179781797917980179811798217983179841798517986179871798817989179901799117992179931799417995179961799717998179991800018001180021800318004180051800618007180081800918010180111801218013180141801518016180171801818019180201802118022180231802418025180261802718028180291803018031180321803318034180351803618037180381803918040180411804218043180441804518046180471804818049180501805118052180531805418055180561805718058180591806018061180621806318064180651806618067180681806918070180711807218073180741807518076180771807818079180801808118082180831808418085180861808718088180891809018091180921809318094180951809618097180981809918100181011810218103181041810518106181071810818109181101811118112181131811418115181161811718118181191812018121181221812318124181251812618127181281812918130181311813218133181341813518136181371813818139181401814118142181431814418145181461814718148181491815018151181521815318154181551815618157181581815918160181611816218163181641816518166181671816818169181701817118172181731817418175181761817718178181791818018181181821818318184181851818618187181881818918190181911819218193181941819518196181971819818199182001820118202182031820418205182061820718208182091821018211182121821318214182151821618217182181821918220182211822218223182241822518226182271822818229182301823118232182331823418235182361823718238182391824018241182421824318244182451824618247182481824918250182511825218253182541825518256182571825818259182601826118262182631826418265182661826718268182691827018271182721827318274182751827618277182781827918280182811828218283182841828518286182871828818289182901829118292182931829418295182961829718298182991830018301183021830318304183051830618307183081830918310183111831218313183141831518316183171831818319183201832118322183231832418325183261832718328183291833018331183321833318334183351833618337183381833918340183411834218343183441834518346183471834818349183501835118352183531835418355183561835718358183591836018361183621836318364183651836618367183681836918370183711837218373183741837518376183771837818379183801838118382183831838418385183861838718388183891839018391183921839318394183951839618397183981839918400184011840218403184041840518406184071840818409184101841118412184131841418415184161841718418184191842018421184221842318424184251842618427184281842918430184311843218433184341843518436184371843818439184401844118442184431844418445184461844718448184491845018451184521845318454184551845618457184581845918460184611846218463184641846518466184671846818469184701847118472184731847418475184761847718478184791848018481184821848318484184851848618487184881848918490184911849218493184941849518496184971849818499185001850118502185031850418505185061850718508185091851018511185121851318514185151851618517185181851918520185211852218523185241852518526185271852818529185301853118532185331853418535185361853718538185391854018541185421854318544185451854618547185481854918550185511855218553185541855518556185571855818559185601856118562185631856418565185661856718568185691857018571185721857318574185751857618577185781857918580185811858218583185841858518586185871858818589185901859118592185931859418595185961859718598185991860018601186021860318604186051860618607186081860918610186111861218613186141861518616186171861818619186201862118622186231862418625186261862718628186291863018631186321863318634186351863618637186381863918640186411864218643186441864518646186471864818649186501865118652186531865418655186561865718658186591866018661186621866318664186651866618667186681866918670186711867218673186741867518676186771867818679186801868118682186831868418685186861868718688186891869018691186921869318694186951869618697186981869918700187011870218703187041870518706187071870818709187101871118712187131871418715187161871718718187191872018721187221872318724187251872618727187281872918730187311873218733187341873518736187371873818739187401874118742187431874418745187461874718748187491875018751187521875318754187551875618757187581875918760187611876218763187641876518766187671876818769187701877118772187731877418775187761877718778187791878018781187821878318784187851878618787187881878918790187911879218793187941879518796187971879818799188001880118802188031880418805188061880718808188091881018811188121881318814188151881618817188181881918820188211882218823188241882518826188271882818829188301883118832188331883418835188361883718838188391884018841188421884318844188451884618847188481884918850188511885218853188541885518856188571885818859188601886118862188631886418865188661886718868188691887018871188721887318874188751887618877188781887918880188811888218883188841888518886188871888818889188901889118892188931889418895188961889718898188991890018901189021890318904189051890618907189081890918910189111891218913189141891518916189171891818919189201892118922189231892418925189261892718928189291893018931189321893318934189351893618937189381893918940189411894218943189441894518946189471894818949189501895118952189531895418955189561895718958189591896018961189621896318964189651896618967189681896918970189711897218973189741897518976189771897818979189801898118982189831898418985189861898718988189891899018991189921899318994189951899618997189981899919000190011900219003190041900519006190071900819009190101901119012190131901419015190161901719018190191902019021190221902319024190251902619027190281902919030190311903219033190341903519036190371903819039190401904119042190431904419045190461904719048190491905019051190521905319054190551905619057190581905919060190611906219063190641906519066190671906819069190701907119072190731907419075190761907719078190791908019081190821908319084190851908619087190881908919090190911909219093190941909519096190971909819099191001910119102191031910419105191061910719108191091911019111191121911319114191151911619117191181911919120191211912219123191241912519126191271912819129191301913119132191331913419135191361913719138191391914019141191421914319144191451914619147191481914919150191511915219153191541915519156191571915819159191601916119162191631916419165191661916719168191691917019171191721917319174191751917619177191781917919180191811918219183191841918519186191871918819189191901919119192191931919419195191961919719198191991920019201192021920319204192051920619207192081920919210192111921219213192141921519216192171921819219192201922119222192231922419225192261922719228192291923019231192321923319234192351923619237192381923919240192411924219243192441924519246192471924819249192501925119252192531925419255192561925719258192591926019261192621926319264192651926619267192681926919270192711927219273192741927519276192771927819279192801928119282192831928419285192861928719288192891929019291192921929319294192951929619297192981929919300193011930219303193041930519306193071930819309193101931119312193131931419315193161931719318193191932019321193221932319324193251932619327193281932919330193311933219333193341933519336193371933819339193401934119342193431934419345193461934719348193491935019351193521935319354193551935619357193581935919360193611936219363193641936519366193671936819369193701937119372193731937419375193761937719378193791938019381193821938319384193851938619387193881938919390193911939219393193941939519396193971939819399194001940119402194031940419405194061940719408194091941019411194121941319414194151941619417194181941919420194211942219423194241942519426194271942819429194301943119432194331943419435194361943719438194391944019441194421944319444194451944619447194481944919450194511945219453194541945519456194571945819459194601946119462194631946419465194661946719468194691947019471194721947319474194751947619477194781947919480194811948219483194841948519486194871948819489194901949119492194931949419495194961949719498194991950019501195021950319504195051950619507195081950919510195111951219513195141951519516195171951819519195201952119522195231952419525195261952719528195291953019531195321953319534195351953619537195381953919540195411954219543195441954519546195471954819549195501955119552195531955419555195561955719558195591956019561195621956319564195651956619567195681956919570195711957219573195741957519576195771957819579195801958119582195831958419585195861958719588195891959019591195921959319594195951959619597195981959919600196011960219603196041960519606196071960819609196101961119612196131961419615196161961719618196191962019621196221962319624196251962619627196281962919630196311963219633196341963519636196371963819639196401964119642196431964419645196461964719648196491965019651196521965319654196551965619657196581965919660196611966219663196641966519666196671966819669196701967119672196731967419675196761967719678196791968019681196821968319684196851968619687196881968919690196911969219693196941969519696196971969819699197001970119702197031970419705197061970719708197091971019711197121971319714197151971619717197181971919720197211972219723197241972519726197271972819729197301973119732197331973419735197361973719738197391974019741197421974319744197451974619747197481974919750197511975219753197541975519756197571975819759197601976119762197631976419765197661976719768197691977019771197721977319774197751977619777197781977919780197811978219783197841978519786197871978819789197901979119792197931979419795197961979719798197991980019801198021980319804198051980619807198081980919810198111981219813198141981519816198171981819819198201982119822198231982419825198261982719828198291983019831198321983319834198351983619837198381983919840198411984219843198441984519846198471984819849198501985119852198531985419855198561985719858198591986019861198621986319864198651986619867198681986919870198711987219873198741987519876198771987819879198801988119882198831988419885198861988719888198891989019891198921989319894198951989619897198981989919900199011990219903199041990519906199071990819909199101991119912199131991419915199161991719918199191992019921199221992319924199251992619927199281992919930199311993219933199341993519936199371993819939199401994119942199431994419945199461994719948199491995019951199521995319954199551995619957199581995919960199611996219963199641996519966199671996819969199701997119972199731997419975199761997719978199791998019981199821998319984199851998619987199881998919990199911999219993199941999519996199971999819999200002000120002200032000420005200062000720008200092001020011200122001320014200152001620017200182001920020200212002220023200242002520026200272002820029200302003120032200332003420035200362003720038200392004020041200422004320044200452004620047200482004920050200512005220053200542005520056200572005820059200602006120062200632006420065200662006720068200692007020071200722007320074200752007620077200782007920080200812008220083200842008520086200872008820089200902009120092200932009420095200962009720098200992010020101201022010320104201052010620107201082010920110201112011220113201142011520116201172011820119201202012120122201232012420125201262012720128201292013020131201322013320134201352013620137201382013920140201412014220143201442014520146201472014820149201502015120152201532015420155201562015720158201592016020161201622016320164201652016620167201682016920170201712017220173201742017520176201772017820179201802018120182201832018420185201862018720188201892019020191201922019320194201952019620197201982019920200202012020220203202042020520206202072020820209202102021120212202132021420215202162021720218202192022020221202222022320224202252022620227202282022920230202312023220233202342023520236202372023820239202402024120242202432024420245202462024720248202492025020251202522025320254202552025620257202582025920260202612026220263202642026520266202672026820269202702027120272202732027420275202762027720278202792028020281202822028320284202852028620287202882028920290202912029220293202942029520296202972029820299203002030120302203032030420305203062030720308203092031020311203122031320314203152031620317203182031920320203212032220323203242032520326203272032820329203302033120332203332033420335203362033720338203392034020341203422034320344203452034620347203482034920350203512035220353203542035520356203572035820359203602036120362203632036420365203662036720368203692037020371203722037320374203752037620377203782037920380203812038220383203842038520386203872038820389203902039120392203932039420395203962039720398203992040020401204022040320404204052040620407204082040920410204112041220413204142041520416204172041820419204202042120422204232042420425204262042720428204292043020431204322043320434204352043620437204382043920440204412044220443204442044520446204472044820449204502045120452204532045420455204562045720458204592046020461204622046320464204652046620467204682046920470204712047220473204742047520476204772047820479204802048120482204832048420485204862048720488204892049020491204922049320494204952049620497204982049920500205012050220503205042050520506205072050820509205102051120512205132051420515205162051720518205192052020521205222052320524205252052620527205282052920530205312053220533205342053520536205372053820539205402054120542205432054420545205462054720548205492055020551205522055320554205552055620557205582055920560205612056220563205642056520566205672056820569205702057120572205732057420575205762057720578205792058020581205822058320584205852058620587205882058920590205912059220593205942059520596205972059820599206002060120602206032060420605206062060720608206092061020611206122061320614206152061620617206182061920620206212062220623206242062520626206272062820629206302063120632206332063420635206362063720638206392064020641206422064320644206452064620647206482064920650206512065220653206542065520656206572065820659206602066120662206632066420665206662066720668206692067020671206722067320674206752067620677206782067920680206812068220683206842068520686206872068820689206902069120692206932069420695206962069720698206992070020701207022070320704207052070620707207082070920710207112071220713207142071520716207172071820719207202072120722207232072420725207262072720728207292073020731207322073320734207352073620737207382073920740207412074220743207442074520746207472074820749207502075120752207532075420755207562075720758207592076020761207622076320764207652076620767207682076920770207712077220773207742077520776207772077820779207802078120782207832078420785207862078720788207892079020791207922079320794207952079620797207982079920800208012080220803208042080520806208072080820809208102081120812208132081420815208162081720818208192082020821208222082320824208252082620827208282082920830208312083220833208342083520836208372083820839208402084120842208432084420845208462084720848208492085020851208522085320854208552085620857208582085920860208612086220863208642086520866208672086820869208702087120872208732087420875208762087720878208792088020881208822088320884208852088620887208882088920890208912089220893208942089520896208972089820899209002090120902209032090420905209062090720908209092091020911209122091320914209152091620917209182091920920209212092220923209242092520926209272092820929209302093120932209332093420935209362093720938209392094020941209422094320944209452094620947209482094920950209512095220953209542095520956209572095820959209602096120962209632096420965209662096720968209692097020971209722097320974209752097620977209782097920980209812098220983209842098520986209872098820989209902099120992209932099420995209962099720998209992100021001210022100321004210052100621007210082100921010210112101221013210142101521016210172101821019210202102121022210232102421025210262102721028210292103021031210322103321034210352103621037210382103921040210412104221043210442104521046210472104821049210502105121052210532105421055210562105721058210592106021061210622106321064210652106621067210682106921070210712107221073210742107521076210772107821079210802108121082210832108421085210862108721088210892109021091210922109321094210952109621097210982109921100211012110221103211042110521106211072110821109211102111121112211132111421115211162111721118211192112021121211222112321124211252112621127211282112921130211312113221133211342113521136211372113821139211402114121142211432114421145211462114721148211492115021151211522115321154211552115621157211582115921160211612116221163211642116521166211672116821169211702117121172211732117421175211762117721178211792118021181211822118321184211852118621187211882118921190211912119221193211942119521196211972119821199212002120121202212032120421205212062120721208212092121021211212122121321214212152121621217212182121921220212212122221223212242122521226212272122821229212302123121232212332123421235212362123721238212392124021241212422124321244212452124621247212482124921250212512125221253212542125521256212572125821259212602126121262212632126421265212662126721268212692127021271212722127321274212752127621277212782127921280212812128221283212842128521286212872128821289212902129121292212932129421295212962129721298212992130021301213022130321304213052130621307213082130921310213112131221313213142131521316213172131821319213202132121322213232132421325213262132721328213292133021331213322133321334213352133621337213382133921340213412134221343213442134521346213472134821349213502135121352213532135421355213562135721358213592136021361213622136321364213652136621367213682136921370213712137221373213742137521376213772137821379213802138121382213832138421385213862138721388213892139021391213922139321394213952139621397213982139921400214012140221403214042140521406214072140821409214102141121412214132141421415214162141721418214192142021421214222142321424214252142621427214282142921430214312143221433214342143521436214372143821439214402144121442214432144421445214462144721448214492145021451214522145321454214552145621457214582145921460214612146221463214642146521466214672146821469214702147121472214732147421475214762147721478214792148021481214822148321484214852148621487214882148921490214912149221493214942149521496214972149821499215002150121502215032150421505215062150721508215092151021511215122151321514215152151621517215182151921520215212152221523215242152521526215272152821529215302153121532215332153421535215362153721538215392154021541215422154321544215452154621547215482154921550215512155221553215542155521556215572155821559215602156121562215632156421565215662156721568215692157021571215722157321574215752157621577215782157921580215812158221583215842158521586215872158821589215902159121592215932159421595215962159721598215992160021601216022160321604216052160621607216082160921610216112161221613216142161521616216172161821619216202162121622216232162421625216262162721628216292163021631216322163321634216352163621637216382163921640216412164221643216442164521646216472164821649216502165121652216532165421655216562165721658216592166021661216622166321664216652166621667216682166921670216712167221673216742167521676216772167821679216802168121682216832168421685216862168721688216892169021691216922169321694216952169621697216982169921700217012170221703217042170521706217072170821709217102171121712217132171421715217162171721718217192172021721217222172321724217252172621727217282172921730217312173221733217342173521736217372173821739217402174121742217432174421745217462174721748217492175021751217522175321754217552175621757217582175921760217612176221763217642176521766217672176821769217702177121772217732177421775217762177721778217792178021781217822178321784217852178621787217882178921790217912179221793217942179521796217972179821799218002180121802218032180421805218062180721808218092181021811218122181321814218152181621817218182181921820218212182221823218242182521826218272182821829218302183121832218332183421835218362183721838218392184021841218422184321844218452184621847218482184921850218512185221853218542185521856218572185821859218602186121862218632186421865218662186721868218692187021871218722187321874218752187621877218782187921880218812188221883218842188521886218872188821889218902189121892218932189421895218962189721898218992190021901219022190321904219052190621907219082190921910219112191221913219142191521916219172191821919219202192121922219232192421925219262192721928219292193021931219322193321934219352193621937219382193921940219412194221943219442194521946219472194821949219502195121952219532195421955219562195721958219592196021961219622196321964219652196621967219682196921970219712197221973219742197521976219772197821979219802198121982219832198421985219862198721988219892199021991219922199321994219952199621997219982199922000220012200222003220042200522006220072200822009220102201122012220132201422015220162201722018220192202022021220222202322024220252202622027220282202922030220312203222033220342203522036220372203822039220402204122042220432204422045220462204722048220492205022051220522205322054220552205622057220582205922060220612206222063220642206522066220672206822069220702207122072220732207422075220762207722078220792208022081220822208322084220852208622087220882208922090220912209222093220942209522096220972209822099221002210122102221032210422105221062210722108221092211022111221122211322114221152211622117221182211922120221212212222123221242212522126221272212822129221302213122132221332213422135221362213722138221392214022141221422214322144221452214622147221482214922150221512215222153221542215522156221572215822159221602216122162221632216422165221662216722168221692217022171221722217322174221752217622177221782217922180221812218222183221842218522186221872218822189221902219122192221932219422195221962219722198221992220022201222022220322204222052220622207222082220922210222112221222213222142221522216222172221822219222202222122222222232222422225222262222722228222292223022231222322223322234222352223622237222382223922240222412224222243222442224522246222472224822249222502225122252222532225422255222562225722258222592226022261222622226322264222652226622267222682226922270222712227222273222742227522276222772227822279222802228122282222832228422285222862228722288222892229022291222922229322294222952229622297222982229922300223012230222303223042230522306223072230822309223102231122312223132231422315223162231722318223192232022321223222232322324223252232622327223282232922330223312233222333223342233522336223372233822339223402234122342223432234422345223462234722348223492235022351223522235322354223552235622357223582235922360223612236222363223642236522366223672236822369223702237122372223732237422375223762237722378223792238022381223822238322384223852238622387223882238922390223912239222393223942239522396223972239822399224002240122402224032240422405224062240722408224092241022411224122241322414224152241622417224182241922420224212242222423224242242522426224272242822429224302243122432224332243422435224362243722438224392244022441224422244322444224452244622447224482244922450224512245222453224542245522456224572245822459224602246122462224632246422465224662246722468224692247022471224722247322474224752247622477224782247922480224812248222483224842248522486224872248822489224902249122492224932249422495224962249722498224992250022501225022250322504225052250622507225082250922510225112251222513225142251522516225172251822519225202252122522225232252422525225262252722528225292253022531225322253322534225352253622537225382253922540225412254222543225442254522546225472254822549225502255122552225532255422555225562255722558225592256022561225622256322564225652256622567225682256922570225712257222573225742257522576225772257822579225802258122582225832258422585225862258722588225892259022591225922259322594225952259622597225982259922600226012260222603226042260522606226072260822609226102261122612226132261422615226162261722618226192262022621226222262322624226252262622627226282262922630226312263222633226342263522636
Next page